Sequencing

16s rRNA Sequencing

DNA Services

16s rRNA Sequencing � Molecular identification of Actinomycetes, Archea, and Bacteria

The traditional Morphological and Biochemical based identification of bacteria is generally not as accurate as identification based on genotypic (Molecular Identification) methods. For identifying bacteria, 16S rRNA gene sequence has emerged as a preferred molecular identification technique. 16S rRNA gene sequence analysis can be more useful for the better identification for poorly described, rarely isolated, or phenotypically aberrant strains, and this technique used to recognise novel / new bacteria and noncultured bacteria (unculturable) .

The 16S rRNA gene sequences used to study bacterial phylogeny and taxonomy. There are some specific reasons there to study 16s rRNA Gene Sequence for Bacterial Identification.

  • 16s rRNA gene is present in almost all bacteria; often it exists as a multigene family, or operons.
  • The 16s rRNA Gene is a conserved gene, and its function has not changed over the time.
  • The 16S rRNA gene size is approximately 1,500 bp. It is showing the nine variable regions that make it an ideal target as a phylogenetic marker gene. It is large enough for informatics purposes. This 16s rRNA study is one of the �gold standard� technique to identify the Actinomycetes, Archea, Bacteria and microbial eukarya. Many studies are describing new species are solely based upon small subunit (SSU) sequences. The emergence of SSU sequence technology has more use in the definition of a species.
  • 16s rRNA gene is part of the translation process. Therefore it is present in all bacteria and by thus it is a perfect universal target for bacterial identification.
  • The 16s rRNA gene consists of conserved and highly variable regions, which increases its detection specificity and also allows for the use of universal primers.
  • rRNA gene evolves at relatively constant rates, i.e. is a molecular clock, which allows to infer phylogenetic relationships

Universal Primer used for amplification 16s rRNA gene:

  • 27F - AGAGTTTGATCMTGGCTCAG
  • 1541R - AAGGAGGTGATCCAGCCGCA

Yaazh Xenomics offering the 16S rRNA gene sequencing service with Sanger DNA Sequencing. Also, we are providing the 16s rRNA Gene sequencing study with the latest Nanopore next-generation sequencing at low cost.

Yaazh Xenomics offers a comprehensive 16SrRNA gene sequencing service for identification and classification of species in microbial samples. We use entire 16S rDNA (V1- V9) fragment amplification strategy, that will be sequenced on the Latest Long read 3rd Generation NGS platform Oxford Nanopore MinION and we provide extensive data analysis using latest bioinformatic tools.

Samples accepted as DNA, Microbial culture / Bacterial culture in agar plate or slant and PCR Product. Yaazh Xenomics has processed Various type Microbial samples which are isolated from the different part of India as well as from other Countries. Yaazh Xenomics have clients from many leading research institutes, Universities and Colleges.

 

to top