Menu
Services / Genomic Services / DNA Sequencing / RBCL Gene Sequencing

RBCL Gene Sequencing

DNA barcoding using the chloroplast genes rbcL and matK for accurate plant species identification.

Introduction

DNA barcoding using the chloroplast genes rbcL and matK is the globally accepted standard method for accurate plant species identification. Recommended by the Consortium for the Barcode of Life (CBOL) Plant Working Group, this two-locus approach enables reliable identification even from small tissue samples, herbarium specimens, seedlings, or processed plant materials.

At Yaazh Xenomics, we provide high-quality Sanger sequencing services for the rbcL and matK genes, delivering precise species-level identification with comprehensive reports and database matching.

RBCL Gene Sequencing

PCR Amplification and Sequencing Workflow

1. DNA Extraction — High-quality genomic DNA extracted from fresh leaves, dried herbarium material, or processed plant samples using CTAB or commercial kits.

2. PCR Amplification — Separate reactions for rbcL and matK using optimized conditions (Taq polymerase, 25–50 ng template DNA).

3. Gel Verification — Confirmation of correct amplicon size.

4. PCR Product Purification — Removal of primers and unincorporated nucleotides.

5. Sanger Sequencing — Bidirectional sequencing (forward + reverse) for high-quality consensus sequences.

6. Sequence Editing & Assembly — Trimming, quality checking, and contig assembly.

7. Database Matching — BLAST against BOLD Systems and NCBI GenBank.

8. Phylogenetic Analysis — Construction of trees for confirmation when needed.

9. Report Generation — Detailed identification report with similarity scores, barcode gap analysis, and species assignment.

Typical turnaround time

5–7 working days from sample receipt.

Advantages and Limitations

Advantages of rbcL + matK Barcoding

Limitations and Considerations

  • matK amplification may fail in some taxonomic groups (certain monocots or highly degraded samples) — alternative primers or supplementary loci (e.g., trnH-psbA or ITS) can be used.
  • Limited resolution for extremely closely related species or recent hybrids.
  • Chloroplast markers reflect only maternal lineage.
  • Requires good-quality starting material for best results.
  • Database coverage is still growing for some regional floras.

The rbcL Gene

Full name: Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit • Function: Encodes the large subunit of Rubisco, the primary enzyme in photosynthetic carbon fixation. • Location: Chloroplast genome (maternally inherited). • Full gene size: Approximately 1,428 bp (coding sequence). • Barcode region used: 5′ end fragment of ~600 bp. This region is highly conserved at the protein level yet sufficiently variable at the nucleotide level, making it an excellent universal marker for initial taxonomic placement at family and genus levels.

The matK Gene

Full name: Maturase K • Function: Encodes a maturase protein involved in the splicing of group II introns within chloroplast transcripts. • Location: Chloroplast genome (located within the trnK intron). • Full gene size: Approximately 1,500–1,600 bp. • Barcode region used: Central variable region of ~800–900 bp. matK evolves faster than rbcL and provides superior species-level discriminatory power, especially when used in combination with rbcL.

Standard Primers and Amplicon Details

Notes on primers: - rbcLa-F/rbcLa-R pair offers >95% amplification success across land plants. - matK-3F/matK-1R pair provides high resolution but may require optimization in certain taxa. - Alternative matK primers (e.g., matK-KIM-F/R) are available if primary amplification fails.

GenePrimer NameSequence (5′→3′)Amplicon SizeAnnealing Temperature
rbcLrbcLa-FATGTCACCACAAACAGAGACTAAAGC~600 bp55 °C
rbcLrbcLa-RGTAAAATCAAGTCCACCRCG~600 bp55 °C
matKmatK-3FCGTACAGTACTTTTGTGTTTACGAG~850 bp50–52 °C
matKmatK-1RACCCAGTCCATCTGGAAATCTTGGTTC~850 bp50–52 °C

Applications

  • • Species-level identification for biodiversity and conservation projects
  • • Authentication of medicinal plants and herbal products
  • • Timber and wildlife forensics
  • • Ecological monitoring and invasive species detection
  • • Germplasm characterization and plant breeding programs
  • • Academic research and herbarium curation
  • • Regulatory compliance and quality control in the food and pharmaceutical industries

Why Choose Yaazh Xenomics?

Expertise: We combine validated primer sets, optimized PCR protocols, high-quality Sanger sequencing, and expert bioinformatics analysis to deliver accurate and reliable plant identification results.

Full Support: Our team provides full technical support, including primer recommendations, troubleshooting, and customized reports tailored to your research or commercial needs.

RBCL Gene Sequencing — Yaazh Xenomics